Identification and Expression Analysis of the Nucleotidyl Transferase Protein (NTP) Family in Soybean (Glycine max) under Various Abiotic Stresses.

Nucleotidyl transferases (NTPs) are common transferases in eukaryotes and play a crucial role in nucleotide modifications at the 3' end of RNA. In plants, NTPs can regulate RNA stability by influencing 3' end modifications, which in turn affect plant growth, development, stress responses, and disease resistance. Although the functions of NTP family members have been extensively studied in Arabidopsis, rice, and maize, there is limited knowledge about NTP genes in soybeans. In this study, we identified 16 members of the NTP family in soybeans, including two subfamilies (G1 and G2) with distinct secondary structures, conserved motifs, and domain distributions at the protein level. Evolutionary analysis of genes in the NTP family across multiple species and gene collinearity analysis revealed a relatively conserved evolutionary pattern. Analysis of the tertiary structure of the proteins showed that NTPs have three conserved aspartic acids that bind together to form a possible active site. Tissue-specific expression analysis indicated that some NTP genes exhibit tissue-specific expression, likely due to their specific functions. Stress expression analysis showed significant differences in the expression levels of NTP genes under high salt, drought, and cold stress. Additionally, RNA-seq analysis of soybean plants subjected to salt and drought stress further confirmed the association of soybean NTP genes with abiotic stress responses. Subcellular localization experiments revealed that GmNTP2 and GmNTP14, which likely have similar functions to HESO1 and URT1, are located in the nucleus. These research findings provide a foundation for further investigations into the functions of NTP family genes in soybeans.

Depletion of tRNA CCA-adding enzyme in Mycobacterium tuberculosis leads to polyadenylation of transcripts and precursor tRNAs.

In reference to gene annotation, more than half of the tRNA species synthesized by Mycobacterium tuberculosis require the enzymatic addition of the cytosine-cytosine-adenine (CCA) tail, which is indispensable for amino acid charging and tRNA functionality. It makes the mycobacterial CCA-adding enzyme essential for survival of the bacterium and a potential target for novel pipelines in drug discovery avenues. Here, we described the rv3907c gene product, originally annotated as poly(A)polymerase (rv3907c, PcnA) as a functional CCA-adding enzyme (CCAMtb) essential for viability of M. tuberculosis. The depletion of the enzyme affected tRNAs maturation, inhibited bacilli growth, and resulted in abundant accumulation of polyadenylated RNAs. We determined the enzymatic activities displayed by the mycobacterial CCAMtb in vitro and studied the effects of inhibiting of its transcription in bacterial cells. We are the first to properly confirm the existence of RNA polyadenylation in mycobacteria, a previously controversial phenomenon, which we found promoted upon CCA-adding enzyme downexpression.

Condensate cooperativity underlies transgenerational gene silencing.

Biomolecular condensates have been shown to interact in vivo, yet it is unclear whether these interactions are functionally meaningful. Here, we demonstrate that cooperativity between two distinct condensates-germ granules and P bodies-is required for transgenerational gene silencing in C. elegans. We find that P bodies form a coating around perinuclear germ granules and that P body components CGH-1/DDX6 and CAR-1/LSM14 are required for germ granules to organize into sub-compartments and concentrate small RNA silencing factors. Functionally, while the P body mutant cgh-1 is competent to initially trigger gene silencing, it is unable to propagate the silencing to subsequent generations. Mechanistically, we trace this loss of transgenerational silencing to defects in amplifying secondary small RNAs and the stability of WAGO-4 Argonaute, both known carriers of gene silencing memories. Together, these data reveal that cooperation between condensates results in an emergent capability of germ cells to establish heritable memory.

Activation of human RNA lariat debranching enzyme Dbr1 by binding protein TTDN1 occurs though an intrinsically disordered C-terminal domain.

In eukaryotic cells, the introns are excised from pre-mRNA by the spliceosome. These introns typically have a lariat configuration due to the 2'-5' phosphodiester bond between an internal branched residue and the 5' terminus of the RNA. The only enzyme known to selectively hydrolyze the 2'-5' linkage of these lariats is the RNA lariat debranching enzyme Dbr1. In humans, Dbr1 is involved in processes such as class-switch recombination of immunoglobulin genes, and its dysfunction is implicated in viral encephalitis, HIV, ALS, and cancer. However, mechanistic details of precisely how Dbr1 affects these processes are missing. Here we show that human Dbr1 contains a disordered C-terminal domain through sequence analysis and nuclear magnetic resonance. This domain stabilizes Dbr1 in vitro by reducing aggregation but is dispensable for debranching activity. We establish that Dbr1 requires Fe2+ for efficient catalysis and demonstrate that the noncatalytic protein Drn1 and the uncharacterized protein trichothiodystrophy nonphotosensitive 1 directly bind to Dbr1. We demonstrate addition of trichothiodystrophy nonphotosensitive 1 to in vitro debranching reactions increases the catalytic efficiency of human Dbr1 19-fold but has no effect on the activity of Dbr1 from the amoeba Entamoeba histolytica, which lacks a disordered C-terminal domain. Finally, we systematically examine how the identity of the branchpoint nucleotide affects debranching rates. These findings describe new aspects of Dbr1 function in humans and further clarify how Dbr1 contributes to human health and disease.

A functional link between lariat debranching enzyme and the intron-binding complex is defective in non-photosensitive trichothiodystrophy.

The pre-mRNA life cycle requires intron processing; yet, how intron-processing defects influence splicing and gene expression is unclear. Here, we find that TTDN1/MPLKIP, which is encoded by a gene implicated in non-photosensitive trichothiodystrophy (NP-TTD), functionally links intron lariat processing to spliceosomal function. The conserved TTDN1 C-terminal region directly binds lariat debranching enzyme DBR1, whereas its N-terminal intrinsically disordered region (IDR) binds the intron-binding complex (IBC). TTDN1 loss, or a mutated IDR, causes significant intron lariat accumulation, as well as splicing and gene expression defects, mirroring phenotypes observed in NP-TTD patient cells. A Ttdn1-deficient mouse model recapitulates intron-processing defects and certain neurodevelopmental phenotypes seen in NP-TTD. Fusing DBR1 to the TTDN1 IDR is sufficient to recruit DBR1 to the IBC and circumvents the functional requirement for TTDN1. Collectively, our findings link RNA lariat processing with splicing outcomes by revealing the molecular function of TTDN1.

An extensive survey of phytoviral RNA 3' uridylation identifies extreme variations and virus-specific patterns.

Viral RNAs can be uridylated in eukaryotic hosts. However, our knowledge of uridylation patterns and roles remains rudimentary for phytoviruses. Here, we report global 3' terminal RNA uridylation profiles for representatives of the main families of positive single-stranded RNA phytoviruses. We detected uridylation in all 47 viral RNAs investigated here, revealing its prevalence. Yet, uridylation levels of viral RNAs varied from 0.2% to 90%. Unexpectedly, most poly(A) tails of grapevine fanleaf virus (GFLV) RNAs, including encapsidated tails, were strictly monouridylated, which corresponds to an unidentified type of viral genomic RNA extremity. This monouridylation appears beneficial for GFLV because it became dominant when plants were infected with nonuridylated GFLV transcripts. We found that GFLV RNA monouridylation is independent of the known terminal uridylyltransferases (TUTases) HEN1 SUPPRESSOR 1 (HESO1) and UTP:RNA URIDYLYLTRANSFERASE 1 (URT1) in Arabidopsis (Arabidopsis thaliana). By contrast, both TUTases can uridylate other viral RNAs like turnip crinkle virus (TCV) and turnip mosaic virus (TuMV) RNAs. Interestingly, TCV and TuMV degradation intermediates were differentially uridylated by HESO1 and URT1. Although the lack of both TUTases did not prevent viral infection, we detected degradation intermediates of TCV RNA at higher levels in an Arabidopsis heso1 urt1 mutant, suggesting that uridylation participates in clearing viral RNA. Collectively, our work unveils an extreme diversity of uridylation patterns across phytoviruses and constitutes a valuable resource to further decipher pro- and antiviral roles of uridylation.

PCYT2-regulated lipid biosynthesis is critical to muscle health and ageing.

Muscle degeneration is the most prevalent cause for frailty and dependency in inherited diseases and ageing. Elucidation of pathophysiological mechanisms, as well as effective treatments for muscle diseases, represents an important goal in improving human health. Here, we show that the lipid synthesis enzyme phosphatidylethanolamine cytidyltransferase (PCYT2/ECT) is critical to muscle health. Human deficiency in PCYT2 causes a severe disease with failure to thrive and progressive weakness. pcyt2-mutant zebrafish and muscle-specific Pcyt2-knockout mice recapitulate the participant phenotypes, with failure to thrive, progressive muscle weakness and accelerated ageing. Mechanistically, muscle Pcyt2 deficiency affects cellular bioenergetics and membrane lipid bilayer structure and stability. PCYT2 activity declines in ageing muscles of mice and humans, and adeno-associated virus-based delivery of PCYT2 ameliorates muscle weakness in Pcyt2-knockout and old mice, offering a therapy for individuals with a rare disease and muscle ageing. Thus, PCYT2 plays a fundamental and conserved role in vertebrate muscle health, linking PCYT2 and PCYT2-synthesized lipids to severe muscle dystrophy and ageing.

New biochemical insights of CCA enzyme role in tRNA maturation and an efficient method to synthesize the 3'-amino-tailed tRNA.

The maturation of tRNA and its quality control is crucial for aminoacylation and protein synthesis. The CCA enzyme, also known as tRNA nucleotidyltransferase, catalyzes the addition or repair of CCA at the 3'-terminus of tRNAs to facilitate aminoacylation. Structural studies of CCA enzyme in complex with ATP and CTP suggested that adding CCA at the 3'-terminus of tRNAs is a sequential process [1-4]. However, there are many inconsistent results of CCA addition from the biochemical studies, which raise the ambiguity about the CCA enzyme specificity in vitro [5-7]. On the other hand, there are no effective methods for preparing the 3'-amino-tailed tRNA to provide a stable amide linkage, which is vital to make homogeneous samples for structural studies of stalling peptides to understand ribosome mediated gene regulation [7-11]. In this study, we examined the functional specificity of the Class II CCA enzyme from E. coli, and optimized the benchmark experimental conditions to prepare the 3'-NH2-tRNA using the CCA enzyme. Our results suggest that the CCA enzyme has a specific ability to catalyze the CCA addition/repair activity within the stoichiometric range of the reactants, and excess amounts of nucleotides lead to non-specific polymerization of the tRNA. Further, we developed an efficient method for synthesizing 3'-amino tRNA, which can facilitate stable aminoacyl/peptidyl-tRNA preparation.

Phosphoethanolamine cytidylyltransferase ameliorates mitochondrial function and apoptosis in hepatocytes in T2DM in vitro.

Liver function indicators are often impaired in patients with type 2 diabetes mellitus (T2DM), who present higher concentrations of aspartate aminotransferase, alanine aminotransferase, and gamma-glutamyl transferase than individuals without diabetes. However, the mechanism of liver injury in patients with T2DM has not been clearly elucidated. In this study, we performed a lipidomics analysis on the liver of T2DM mice, and we found that phosphatidylethanolamine (PE) levels were low in T2DM, along with an increase in diglyceride, which may be due to a decrease in the levels of phosphoethanolamine cytidylyltransferase (Pcyt2), thus likely affecting the de novo synthesis of PE. The phosphatidylserine decarboxylase pathway did not change significantly in the T2DM model, although both pathways are critical sources of PE. Supplementation with CDP-ethanolamine (CDP-etn) to increase the production of PE from the CDP-etn pathway reversed high glucose and FFA (HG&FFA)-induced mitochondrial damage including increased apoptosis, decreased ATP synthesis, decreased mitochondrial membrane potential, and increased reactive oxygen species, whereas supplementation with lysophosphatidylethanolamine, which can increase PE production in the phosphatidylserine decarboxylase pathway, did not. Additionally, we found that overexpression of PCYT2 significantly ameliorated ATP synthesis and abnormal mitochondrial morphology induced by HG&FFA. Finally, the BAX/Bcl-2/caspase3 apoptosis pathway was activated in hepatocytes of the T2DM model, which could also be reversed by CDP-etn supplements and PCYT2 overexpression. In summary, in the liver of T2DM mice, Pcyt2 reduction may lead to a decrease in the levels of PE, whereas CDP-etn supplementation and PCYT2 overexpression ameliorate partial mitochondrial function and apoptosis in HG&FFA-stimulated L02 cells.

Terminal Uridylyltransferases TUT4/7 Regulate microRNA and mRNA Homeostasis.

The terminal nucleotidyltransferases TUT4 and TUT7 (TUT4/7) regulate miRNA and mRNA stability by 3' end uridylation. In humans, TUT4/7 polyuridylates both mRNA and pre-miRNA, leading to degradation by the U-specific exonuclease DIS3L2. We investigate the role of uridylation-dependent decay in maintaining the transcriptome by transcriptionally profiling TUT4/7 deleted cells. We found that while the disruption of TUT4/7 expression increases the abundance of a variety of miRNAs, the let-7 family of miRNAs is the most impacted. Eight let-7 family miRNAs were increased in abundance in TUT4/7 deleted cells, and many let-7 mRNA targets are decreased in abundance. The mRNAs with increased abundance in the deletion strain are potential direct targets of TUT4/7, with transcripts coding for proteins involved in cellular stress response, rRNA processing, ribonucleoprotein complex biogenesis, cell-cell signaling, and regulation of metabolic processes most affected in the TUT4/7 knockout cells. We found that TUT4/7 indirectly control oncogenic signaling via the miRNA let-7a, which regulates AKT phosphorylation status. Finally, we find that, similar to fission yeast, the disruption of uridylation-dependent decay leads to major rearrangements of the transcriptome and reduces cell proliferation and adhesion.

Crystal Structure of the RNA Lariat Debranching Enzyme Dbr1 with Hydrolyzed Phosphorothioate RNA Product.

The RNA lariat debranching enzyme is the sole enzyme responsible for hydrolyzing the 2'-5' phosphodiester bond in RNA lariats produced by the spliceosome. Here, we test the ability of Dbr1 to hydrolyze branched RNAs (bRNAs) that contain a 2'-5'-phosphorothioate linkage, a modification commonly used to resist degradation. We attempted to cocrystallize a phosphorothioate-branched RNA (PS-bRNA) with wild-type Entamoeba histolytica Dbr1 (EhDbr1) but observed in-crystal hydrolysis of the phosphorothioate bond. The crystal structure revealed EhDbr1 in a product-bound state, with the hydrolyzed 2'-5' fragment of the PS-bRNA mimicking the binding mode of the native bRNA substrate. These findings suggest that product inhibition may contribute to the kinetic mechanism of Dbr1. We show that Dbr1 enzymes cleave phosphorothioate linkages at rates ∼10,000-fold more slowly than native phosphate linkages. This new product-bound crystal structure offers atomic details, which can aid inhibitor design. Dbr1 inhibitors could be therapeutic or investigative compounds for human diseases such as human immunodeficiency virus (HIV), amyotrophic lateral sclerosis (ALS), cancer, and viral encephalitis.

TENT2, TUT4, and TUT7 selectively regulate miRNA sequence and abundance.

TENTs generate miRNA isoforms by 3' tailing. However, little is known about how tailing regulates miRNA function. Here, we generate isogenic HEK293T cell lines in which TENT2, TUT4 and TUT7 are knocked out individually or in combination. Together with rescue experiments, we characterize TENT-specific effects by deep sequencing, Northern blot and in vitro assays. We find that 3' tailing is not random but highly specific. In addition to its known adenylation, TENT2 contributes to guanylation and uridylation on mature miRNAs. TUT4 uridylates most miRNAs whereas TUT7 is dispensable. Removing adenylation has a marginal impact on miRNA levels. By contrast, abolishing uridylation leads to dysregulation of a set of miRNAs. Besides let-7, miR-181b and miR-222 are negatively regulated by TUT4/7 via distinct mechanisms while the miR-888 cluster is upregulated specifically by TUT7. Our results uncover the selective actions of TENTs in generating 3' isomiRs and pave the way to investigate their functions.

Molecular mechanism underlying the di-uridylation activity of Arabidopsis TUTase URT1.

In Arabidopsis, HESO1 and URT1 act cooperatively on unmethylated miRNA and mRNA uridylation to induce their degradation. Their collaboration significantly impacts RNA metabolism in plants. However, the molecular mechanism determining the functional difference and complementarity of these two enzymes remains unclear. We previously solved the three-dimensional structure of URT1 in the absence and presence of UTP. In this study, we further determined the structure of URT1 in complex with a 5'-AAAU-3' RNA stretch that mimics the post-catalytic state of the mRNA poly(A) tail after the addition of the first uridine. Structural analysis and enzymatic assays revealed that L527 and Y592 endow URT1 with a preference to interact with purine over pyrimidine at the -1 RNA binding position, thus controlling the optimal number of uridine added to the 3' extremity of poly(A) as two. In addition, we observed that a large-scale conformational rearrangement in URT1 occurs upon binding with RNA from an 'open' to a 'closed' state. Molecular dynamic simulation supports an open-closed conformational selection mechanism employed by URT1 to interact with RNA substrates and maintain distributive enzymatic activity. Based on the above results, a model regarding the catalytic cycle of URT1 is proposed to explain its di-uridylation activity.

TRIM-NHL protein, NHL-2, modulates cell fate choices in the C. elegans germ line.

Many tissues contain multipotent stem cells that are critical for maintaining tissue function. In Caenorhabditis elegans, germline stem cells allow gamete production to continue in adulthood. In the gonad, GLP-1/Notch signaling from the distal tip cell niche to neighboring germ cells activates a complex regulatory network to maintain a stem cell population. GLP-1/Notch signaling positively regulates production of LST-1 and SYGL-1 proteins that, in turn, interact with a set of PUF/FBF proteins to positively regulate the stem cell fate. We previously described sog (suppressor of glp-1 loss of function) and teg (tumorous enhancer of glp-1 gain of function) genes that limit the stem cell fate and/or promote the meiotic fate. Here, we show that sog-10 is allelic to nhl-2. NHL-2 is a member of the conserved TRIM-NHL protein family whose members can bind RNA and ubiquitinate protein substrates. We show that NHL-2 acts, at least in part, by inhibiting the expression of PUF-3 and PUF-11 translational repressor proteins that promote the stem cell fate. Two other negative regulators of stem cell fate, CGH-1 (conserved germline helicase) and ALG-5 (Argonaute protein), may work with NHL-2 to modulate the stem cell population. In addition, NHL-2 activity promotes the male germ cell fate in XX animals.

Uridylation and the SKI complex orchestrate the Calvin cycle of photosynthesis through RNA surveillance of TKL1 in Arabidopsis.

RNA uridylation, catalyzed by terminal uridylyl transferases (TUTases), represents a conserved and widespread posttranscriptional RNA modification in eukaryotes that affects RNA metabolism. In plants, several TUTases, including HEN1 SUPPRESSOR 1 (HESO1) and UTP: RNA URIDYLYLTRANSFERASE (URT1), have been characterized through genetic and biochemical approaches. However, little is known about their physiological significance during plant development. Here, we show that HESO1 and URT1 act cooperatively with the cytoplasmic 3'-5' exoribonucleolytic machinery component SUPERKILLER 2 (SKI2) to regulate photosynthesis through RNA surveillance of the Calvin cycle gene TRANSKETOLASE 1 (TKL1) in Arabidopsis. Simultaneous dysfunction of HESO1, URT1, and SKI2 resulted in leaf etiolation and reduced photosynthetic efficiency. In addition, we detected massive illegitimate short interfering RNAs (siRNAs) from the TKL1 locus in heso1 urt1 ski2, accompanied by reduced TKL1/2 expression and attenuated TKL activities. Consequently, the metabolic analysis revealed that the abundance of many Calvin cycle intermediates is dramatically disturbed in heso1 urt1 ski2. Importantly, all these molecular and physiological defects were largely rescued by the loss-of-function mutation in RNA-DEPENDENT RNA POLYMERASE 6 (RDR6), demonstrating illegitimate siRNA-mediated TKL silencing. Taken together, our results suggest that HESO1- and URT1-mediated RNA uridylation connects to the cytoplasmic RNA degradation pathway for RNA surveillance, which is crucial for TKL expression and photosynthesis in Arabidopsis.

The ZCCHC14/TENT4 complex is required for hepatitis A virus RNA synthesis.

Despite excellent vaccines, resurgent outbreaks of hepatitis A have caused thousands of hospitalizations and hundreds of deaths within the United States in recent years. There is no effective antiviral therapy for hepatitis A, and many aspects of the hepatitis A virus (HAV) replication cycle remain to be elucidated. Replication requires the zinc finger protein ZCCHC14 and noncanonical TENT4 poly(A) polymerases with which it associates, but the underlying mechanism is unknown. Here, we show that ZCCHC14 and TENT4A/B are required for viral RNA synthesis following translation of the viral genome in infected cells. Cross-linking immunoprecipitation sequencing (CLIP-seq) experiments revealed that ZCCHC14 binds a small stem-loop in the HAV 5' untranslated RNA possessing a Smaug recognition-like pentaloop to which it recruits TENT4. TENT4 polymerases lengthen and stabilize the 3' poly(A) tails of some cellular and viral mRNAs, but the chemical inhibition of TENT4A/B with the dihydroquinolizinone RG7834 had no impact on the length of the HAV 3' poly(A) tail, stability of HAV RNA, or cap-independent translation of the viral genome. By contrast, RG7834 inhibited the incorporation of 5-ethynyl uridine into nascent HAV RNA, indicating that TENT4A/B function in viral RNA synthesis. Consistent with potent in vitro antiviral activity against HAV (IC50 6.11 nM), orally administered RG7834 completely blocked HAV infection in Ifnar1-/- mice, and sharply reduced serum alanine aminotransferase activities, hepatocyte apoptosis, and intrahepatic inflammatory cell infiltrates in mice with acute hepatitis A. These results reveal requirements for ZCCHC14-TENT4A/B in hepatovirus RNA synthesis, and suggest that TENT4A/B inhibitors may be useful for preventing or treating hepatitis A in humans.

Kinetic and Mechanistic Studies of the Terminal Uridylyltransferase, Zcchc11 (TUT4).

Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Km,RNA; kcat,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3' terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP ≫ GTP. Selectivity is manifested in Km,XTP, with kcat,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3'-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).

Large RNP granules in Caenorhabditis elegans oocytes have distinct phases of RNA-binding proteins.

The germ line provides an excellent in vivo system to study the regulation and function of RNP granules. Germ granules are conserved germ line-specific RNP granules that are positioned in the Caenorhabditis elegans adult gonad to function in RNA maintenance, regulation, and surveillance. In Caenorhabditis elegans, when oogenesis undergoes extended meiotic arrest, germ granule proteins and other RNA-binding proteins assemble into much larger RNP granules whose hypothesized function is to regulate RNA metabolism and maintain oocyte quality. To gain insight into the function of oocyte RNP granules, in this report, we characterize distinct phases for four protein components of RNP granules in arrested oocytes. We find that the RNA-binding protein PGL-1 is dynamic and has liquid-like properties, while the intrinsically disordered protein MEG-3 has gel-like properties, similar to the properties of the two proteins in small germ granules of embryos. We find that MEX-3 exhibits several gel-like properties but is more dynamic than MEG-3, while CGH-1 is dynamic but does not consistently exhibit liquid-like characteristics and may be an intermediate phase within RNP granules. These distinct phases of RNA-binding proteins correspond to, and may underlie, differential responses to stress. Interestingly, in oocyte RNP granules, MEG-3 is not required for the condensation of PGL-1 or other RNA-binding proteins, which differs from the role of MEG-3 in small, embryonic germ granules. Lastly, we show that the PUF-5 translational repressor appears to promote MEX-3 and MEG-3 condensation into large RNP granules; however, this role may be associated with regulation of oogenesis.

Cancer Malignancy Is Correlated with Upregulation of PCYT2-Mediated Glycerol Phosphate Modification of α-Dystroglycan.

The dystrophin-glycoprotein complex connects the cytoskeleton with base membrane components such as laminin through unique O-glycans displayed on α-dystroglycan (α-DG). Genetic impairment of elongation of these glycans causes congenital muscular dystrophies. We previously identified that glycerol phosphate (GroP) can cap the core part of the α-DG O-glycans and terminate their further elongation. This study examined the possible roles of the GroP modification in cancer malignancy, focusing on colorectal cancer. We found that the GroP modification critically depends on PCYT2, which serves as cytidine 5'-diphosphate-glycerol (CDP-Gro) synthase. Furthermore, we identified a significant positive correlation between cancer progression and GroP modification, which also correlated positively with PCYT2 expression. Moreover, we demonstrate that GroP modification promotes the migration of cancer cells. Based on these findings, we propose that the GroP modification by PCYT2 disrupts the glycan-mediated cell adhesion to the extracellular matrix and thereby enhances cancer metastasis. Thus, the present study suggests the possibility of novel approaches for cancer treatment by targeting the PCYT2-mediated GroP modification.